Community
    • Login

    UDL syntax highlighting: non-delimited keywords (for nucleotide sequences)

    Scheduled Pinned Locked Moved General Discussion
    20 Posts 5 Posters 2.8k Views 1 Watching
    Loading More Posts
    • Oldest to Newest
    • Newest to Oldest
    • Most Votes
    Reply
    • Reply as topic
    Log in to reply
    This topic has been deleted. Only users with topic management privileges can see it.
    • PeterJonesP Offline
      PeterJones
      last edited by

      @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

      @guy038 is dyslexic – no

      Actually, @guy038 is French. “DNA”:“Deoxyribonucleic acid”::“ADN”:“acide désoxyribonucléique”, per a quick google search.

      1 Reply Last reply Reply Quote 2
      • PeterJonesP Offline
        PeterJones
        last edited by

        @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

        regexes[(0, (252, 173, 67))] = (r’a’, 0)
        regexes[(1, (152, 73, 167))] = (r’g’, 0)
        regexes[(2, (52, 37, 176))] = (r’c’, 0)
        regexes[(3, (25, 17, 77))] = (r’t’, 0)

        I finally gave in and actually tried using the script. It does work fairly easily, like you showed.

        I confirmed with the following data that it is case sensitive.

        gattaca
        acctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
        gataccgctgg
        

        Thus,

        regexes[(0, (252, 173, 67))] = (r'[Aa]', 0)
        regexes[(1, (152, 73, 167))] = (r'[Gg]', 0)
        regexes[(2, (52, 37, 176))] = (r'[Cc]', 0)
        regexes[(3, (25, 17, 77))] = (r'[Tt]', 0)
        

        will use Alan’s same colours, but allow lower case or upper case.

        To make it automatic, I added the following to the startup.py (by Plugins > Python Script > Scripts, then Ctrl+Click on startup)

        # to automatically import eko's EnhanceUDLLexer:
        d = notepad.getPluginConfigDir() + '\\PythonScript\\scripts\\'
        sys.path.append(d)
        import EnhanceUDLLexer
        EnhanceUDLLexer.EnhanceUDLLexer().main()
        

        When you exit and reload Notepad++, DNA files should now automatically be colored.

        However, as Alan said, @guy038’s macro is probably easier to use for someone who doesn’t already use PythonScript (or for anytime that Notepad++ updates break PythonScript notifications/callbacks).

        1 Reply Last reply Reply Quote 3
        • guy038G Offline
          guy038
          last edited by guy038

          Hello, @n-iels, @alan-kilborn, @peterjones and All,

          Thanks, Alan, for your kind words ! Yes, Peter is just right about it : ADN ( “Acide désoxyribonucléique” ) is simply the French initialism for DNA ( “Deoxyribonucleic acid” ). So, I’m not thinking, yet, as native English-American people ? My bad ;-))

          By the way, do you know the difference between an acronym and an initialism ?

          
          Acronym             Signification                                 Syntactic details                                  Pronunciation
          ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
           GIF         Graphics Interchange Format      Pure acronym, formed from initial letters                             As a SINGLE word
           Radar       Radio Detection And Ranging      Pure acronym, formed from both initial and non-initial letters        As a SINGLE word
           CD-ROM      Compact Disc Read-Only Memory    Both, acronym and initialism, formed from initial letters              _C_  _D_  _Rom_
           DNA         DeoxyriboNucleic Acid            Pure initialism, formed from both initial and non-initial letters      _D_  _N_  _A_
           HTML        HyperText Markup Language        Pure initialism, formed from both initial and non-initial letters      _H_  _T_  _M_  _L_
           VHF         Very High Frequency”             Pure initialism, formed from initial letters                           _V_  _H_  _F_  
          
          From :  https://en.wikipedia.org/wiki/Acronym#Nomenclature
          
          and  :  https://en.wikipedia.org/wiki/Acronym#Comparing_a_few_examples_of_each_type
          

          Now, regarding the macro, I simply used the default N++ colors of the Mark styles. I just avoided the 4th style, which seems too dark purple, to my mind ! Of course, all these style colors can be changed in Settings > Style Configurator... > Global styles > Mark Style #1 to #5 ;-))

          Best Regards,

          guy038

          Alan KilbornA 1 Reply Last reply Reply Quote 1
          • Alan KilbornA Offline
            Alan Kilborn @guy038
            last edited by

            @guy038 said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

            do you know the difference between an acronym and an initialism

            I don’t. I still don’t. And I don’t know why it is important enough for their to be a distinction. :-)

            1 Reply Last reply Reply Quote 0
            • guy038G Offline
              guy038
              last edited by guy038

              Hi, @alan-kilborn and All,

              When I was elaborating my answer to you, about the "ADN -DNA" difference, I thought , of course, about the French name acronyme to describe these things, with the intention of choosing the correct English word, afterwards, which I would had inserted in my post.

              So, after a search on wikipedia.fr I was surprised to learn that different kinks of acronyms exist. Particularly, the two main families :

              • True acronyms, ( French word : acronymes ), which are pronounced as a single word
              • Pseudo acronyms,called initialisms ( French word : sigles ), which are pronounced as individual letters

              For instance, in the Wikipedia article, it it said :

              … some dictionaries and usage commentators define acronym to mean an abbreviation that is pronounced as a word, in contrast to an initialism (or alphabetism)‍—‌an abbreviation formed from a string of initials (and possibly pronounced as individual letters)…

              So, it’s out of curiosity that I noticed these differences. Just consider that @guy038’s mind was rather creating a useless story ;-)) And, of course, absolutely no relation at all with Notepad++ and @n-iels problem ;-))

              Last remark :

              I have often noticed that people who know several languages are more respectful of their own language ! For example, I don’t like the “Frenglish” terms. In my opinion, it’s just an honor to speak and write well in each language ! Of course, I do understand that no language is really fixed and everyone evolves on their own ;-))

              Best Regards

              guy038

              N ielsN 1 Reply Last reply Reply Quote 1
              • N ielsN Offline
                N iels @guy038
                last edited by

                Thanks, you are amazing… I have now tried both solutions:

                The Python script by @Ekopalypse works nicely, but has the following problems:

                1. It slows Notepad++ down dramatically, to the point that working with a medium-size sequence file (500 k chars, mostly dashes) becomes impossible.
                2. The script does not allow you to style the background. But background styling is what we usually want for this purpose.
                3. Also, I noticed, that you cannot invoke the script twice (e.g. after changing colors).

                BTW, the standard colors that I prefer would be:

                regexes[(0, (224,   0,   0))] = (r'[tTuU]', 0) # red
                regexes[(1, (  2, 140,   0))] = (r'[aA]'  , 0) # green
                regexes[(2, (  0,   0, 230))] = (r'[cC]'  , 0) # blue
                # regexes[(3, (  0,   0,   0))] = (r'[gG]'  , 0) # black (default)
                

                As for the macro by @guy038:

                1. It is much faster and actually makes editing the sequence file from above possible.
                2. But on one of my computers, the A’s are not styled (I still have the standard colors set in the style configurator).
                3. Understanding and editing the macro code is almost impossible and I could not find a useful macro documentation that is online (most links point to the now defunct npp wiki). It would be nice to have the same algorithm in Python Script…
                4. The macro is not dynamic, i.e. after editing your sequences, you have to manually re-invoke that macro. Until then, your new sequence is styled wrong or not at all.

                Both solutions allow me to finish my current project (thanks again!). But the preferable solution for non-hackers would be to make this a standard language (“Nucleotides”) after enhancing the UDL highlighter as discussed on the bug tracker: https://github.com/notepad-plus-plus/notepad-plus-plus/issues/7622.

                EkopalypseE Alan KilbornA PeterJonesP 3 Replies Last reply Reply Quote 2
                • EkopalypseE Offline
                  Ekopalypse @N iels
                  last edited by Ekopalypse

                  @N-iels

                  Thank you very much for the testing and feedback of the test results.
                  I’m afraid your use case reaches the limits of the script.
                  Since the script only colors the current visual area, you seem to have very long lines with many hits, which leads to delays.
                  The script is currently using, as you mentioned earlier, the
                  textforeground indicator, this could be changed to get the same format as Guy’s solution.
                  A restart of the script can be accomplished by deleting the class EnhanceUDLLexer via the PythonScript Console,
                  with del EnhanceUDLLexer and another start.

                  Can you tell me how much data you currently have, i.e. how long individual lines are in the visual area?
                  I’d like to see if it’s possible to optimize the script, but I’m afraid, as I’ve said, this probably won’t do much good.

                  But I understand, that a native support would be the preferred solution.

                  1 Reply Last reply Reply Quote 0
                  • Alan KilbornA Offline
                    Alan Kilborn @N iels
                    last edited by

                    @N-iels said :

                    It slows Notepad++ down dramatically, to the point that working with a medium-size sequence file (500 k chars, mostly dashes) becomes impossible.

                    @Ekopalypse said :

                    Since the script only colors the current visual area, you seem to have very long lines with many hits, which leads to delays.

                    @Ekopalypse Deja vu? :-)

                    EkopalypseE 1 Reply Last reply Reply Quote 2
                    • PeterJonesP Offline
                      PeterJones @N iels
                      last edited by

                      @N-iels said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                      I could not find a useful macro documentation that is online

                      There is an overview of recording macros in the official documentation at https://npp-user-manual.org/docs/macros/, and a more-detailed description of the <Macros> section of shortcuts.xml at https://npp-user-manual.org/docs/config-files/#macros, with links to the list of Notepad++ and Scintilla messages that the <Action> tags can refer to.

                      1 Reply Last reply Reply Quote 2
                      • EkopalypseE Offline
                        Ekopalypse @Alan Kilborn
                        last edited by

                        @Alan-Kilborn

                        hehe :-) I guess :-D
                        Sometimes rectangles might be useful :-)) (@all sorry, that’s an insider)

                        1 Reply Last reply Reply Quote 0
                        • Alan KilbornA Offline
                          Alan Kilborn
                          last edited by Alan Kilborn

                          @N-iels said :

                          Understanding and editing the macro code is almost impossible

                          TBH, most people never attempt to edit it, except maybe to slightly tweak it, or to do something that is not normally possible. What people do is to record their actions with the macro recorder. @guy038 probably did this when deriving his solution, followed possibly by some hand-tweaking.

                          It would be nice to have the same algorithm in Python Script

                          I think the macro solution is a good one. While it would be possible to duplicate the functionality with Pythonscript, I don’t know that it is worth the effort, except maybe for instructional (how would one do it) purposes…hmmm…

                          1 Reply Last reply Reply Quote 0
                          • PeterJonesP Offline
                            PeterJones
                            last edited by

                            @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                            except maybe for instructional (how would one do it) purposes

                            Beat you to it. :-)

                            # encoding=utf-8
                            """in response to https://notepad-plus-plus.org/community/topic/18512/
                            
                            Convert this MACRO into PythonScript
                            
                                    <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0">
                                        <Action type="2" message="0"    wParam="43032" lParam="0" sParam=""  />   <!--  DELETE ALL styles        --> <!-- NPPM_ -->
                                        <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      --> <!-- SCI_ NoString -->
                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="A" />   <!--  Write the letter A       --> <!-- SCI_ YesString -->
                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="T" />   <!--  Write the letter T       --> <!-- SCI_ YesString -->
                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="G" />   <!--  Write the letter G       --> <!-- SCI_ YesString -->
                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="C" />   <!--  Write the letter C       --> <!-- SCI_ YesString -->
                                        <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                        <Action type="2" message="0"    wParam="43022" lParam="0" sParam=""  />   <!--  Apply the 1st STYLE      --> <!-- NPPM_ -->
                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                        <Action type="2" message="0"    wParam="43024" lParam="0" sParam=""  />   <!--  Apply the 2nd STYLE      --> <!-- NPPM_ -->
                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                        <Action type="2" message="0"    wParam="43026" lParam="0" sParam=""  />   <!--  Apply the 3rd STYLE      --> <!-- NPPM_ -->
                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                        <Action type="2" message="0"    wParam="43030" lParam="0" sParam=""  />   <!--  Apply the 5th STYLE      --> <!-- NPPM_ -->
                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2454" wParam="0"     lParam="0" sParam=""  />   <!--  Select to START of line  --> <!-- SCI_ NoString -->
                                        <Action type="0" message="2180" wParam="0"     lParam="0" sParam=""  />   <!--  Hit on the DELETE key    --> <!-- SCI_ NoString -->
                                    </Macro>
                            
                            https://www.bioinformatics.org/sms2/random_dna.html
                            
                            catctaaagggattagttcctgccctcatattcactatccgacccctttaactgtgatgt
                            cctcgctttttctcgtgagagctgtgaatctttgtgccgtttccaacaaggcctggagcc
                            ttttcaatgcttgagggtttcaccgcgggtctaacggatgctaagaaaggggtgcggagg
                            aagggtctttatgctggccgtcggcggttgagagctctgacctataccatggatcccgcg
                            agcgcggttacgggcaataagggcctcactatgcctcgaacacattgtggacaaagtgta
                            gtcgaacccacacacgcgcgagactttagggtgtcgaacagtaccatctaattgatggga
                            agaaatggtttcgtaccacccccgtcgctcagcttagacgggccagagaggggatgggtg
                            gtcagtggcgtcggttggtgaccgtagaattcgttacagagcgatgttgtatagcttttt
                            agacgtaggctagcgttttaacttctacaactccagtgattgggttgatggtctgtttgc
                            ttaccagtcaggtcagctcccgctcatggttctctcgcaaattacttggtcacaccgtga
                            aagctccacgcaaactaatagtgggattctacactaaagggcgtcactatcacttcttat
                            acattatagacgtaactacagtagacatactcgcaagcccgctaacgggagcacagatgt
                            tgagggtatcagcttctgcgactcgggctggatccgatatttttatgcaatgcatctgag
                            actggcctccctgctacctctacggaagctggtacgaagcgcgctgccttcgactgaaac
                            ttgcatgcataagttaatgtagtgcagcgcaggtcagccaacataagtagtgagcccagc
                            cgctggcaggacagttgtcgcggtaaatcacacgtgtggtgaccatctccccatttacag
                            gtgttagaaaagcaacttcgtattaatccattaatctgag
                            
                            
                            """
                            notepad.menuCommand(43032)      #   <!--  DELETE ALL styles        -->      IDM_SEARCH_CLEARALLMARKS = Search > Unmark All > Clear All Styles
                            editor.vCHomeWrap()             #   <!--  Go to START of line      -->
                            editor.replaceSel("A")          #   <!--  Write the letter A       -->
                            editor.replaceSel("T")          #   <!--  Write the letter T       -->
                            editor.replaceSel("G")          #   <!--  Write the letter G       -->
                            editor.replaceSel("C")          #   <!--  Write the letter C       -->
                            editor.vCHomeWrap()             #   <!--  Go to START of line      -->
                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                            notepad.menuCommand(43022)      #   <!--  Apply the 1st STYLE      -->      Search > Mark All > Using 1st Style
                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                            notepad.menuCommand(43024)      #   <!--  Apply the 2nd STYLE      -->      Search > Mark All > Using 2nd Style
                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                            notepad.menuCommand(43026)      #   <!--  Apply the 3rd STYLE      -->      Search > Mark All > Using 3rd Style
                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                            notepad.menuCommand(43030)      #   <!--  Apply the 5th STYLE      -->      Search > Mark All > Using 5th Style
                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                            editor.vCHomeWrapExtend()       #   <!--  Select to START of line  -->
                            editor.clear()                  #   <!--  Hit on the DELETE key    -->
                            
                            # use notepad.menuCommand(43032) or Search > Unmark All > Clear All Styles to clear the styles when done
                            
                            1 Reply Last reply Reply Quote 2

                            Hello! It looks like you're interested in this conversation, but you don't have an account yet.

                            Getting fed up of having to scroll through the same posts each visit? When you register for an account, you'll always come back to exactly where you were before, and choose to be notified of new replies (either via email, or push notification). You'll also be able to save bookmarks and upvote posts to show your appreciation to other community members.

                            With your input, this post could be even better 💗

                            Register Login
                            • First post
                              Last post
                            The Community of users of the Notepad++ text editor.
                            Powered by NodeBB | Contributors