Interesting, thanks for the investigastion. From my experience it feels like something with getting the focus back to the file. as if “Ctrl+R” is leading to have the focus on the current file lost, after the reload it is regained. When the focus is regained, the check for modification kicks in and if the file was modified in the mean time, it asks if the file should be reloaded. If the focus is lost, maybe it is possible to reload with Ctrl+R without having the focus lost?

Reading your posting reminded me on the first posting in this thread and the sidenote: since “Monitoring tail -f” doesn’t work as I expect it.

The “eye-button” also known as since “Monitoring tail -f” would solve this issue, if it worked as I’d expect it. I experience the same as here: https://github.com/notepad-plus-plus/notepad-plus-plus/issues/4955

Sorry, I was mistaking the Session Manager plugin with the NPP Favorites plugin, which automatically shows up on the right-hand side. This also explains why my sessions were all missing.

Thanks for the help.

@plidos

You could install the XML Tools plugin and use its XSLT Transformation feature.

Open Plugins Admin and install XML Tools plugin. After Notepad++ has been restarted paste the XSLT code from below to an empty tab and save it for example as ChangeVisible.xsl. Open the XML file you want to process. Go to (menu) Plugins -> XML Tools -> XSLT Transformation. In the dialog popping up click on the ellipsis button and in the file selector dialog popping up select the XSL file you created in step 2. In the options field of the dialog type UPCid='1234'. Click the Transform button. A new document will be opened with your changes applied. Save it to the original file.

To change the value of the IsVisible node of more than one Item nodes, repeat steps 6 to 8.

The XSLT code. Please note: In line 19 (<xsl:template match="/RootNode/Item/IsVisible">) you have to provide the complete path to the IsVisible XML node, starting from the document’s root node.

<?xml version="1.0" encoding="UTF-8"?> <xsl:transform version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output method="xml" omit-xml-declaration="no" indent="yes" /> <xsl:param name="UPCid"/> <xsl:template match="@*|node()"> <xsl:copy> <xsl:apply-templates select="@*|node()"/> </xsl:copy> </xsl:template> <xsl:template match="/RootNode/Item/IsVisible"> <xsl:choose> <xsl:when test="../@UPC=$UPCid"> <xsl:copy> <xsl:copy-of select="@*"/> <xsl:text>False</xsl:text> </xsl:copy> </xsl:when> <xsl:otherwise> <xsl:copy> <xsl:copy-of select="@*|node()"/> </xsl:copy> </xsl:otherwise> </xsl:choose> </xsl:template> </xsl:transform>

@Brian-Hart said in Minor nuisance: "N" no longer selects "No":

And likely nobody else will care or even notice

hehehe.

https://community.notepad-plus-plus.org/topic/18544/new-v7-8-enhancement-in-save-dialog-is-missing-keyboard-shortcuts https://community.notepad-plus-plus.org/topic/18513/shortcut-keys-in-save-dialog-no-longer-working https://community.notepad-plus-plus.org/post/48004 https://github.com/notepad-plus-plus/notepad-plus-plus/issues/6223

In other words, it’s known about. Note that last one is the official issue-tracker; should be fixed in the next version released (ie, whatever comes after v7.8.1)

@Eran-Blecher
Notepad +++ opens any text files, and the * .json extension is a text format))
Install the JSTool plugin for formatting * .JSON files, and it will become much more convenient to work with this format!

Imgur

@Alan-Kilborn SOLVED! I realized that I had to select Python in the drop down box, not leave it at [Default]. Thanks very much!

@gstavi said in (((This is a bug)) since the first day) I join Notepad++:

Managed to dig the ticket I posted on sourceforge.

In the linked ticket, @donho said:

The current behaviour is preferable comparing with the one you suggested.

He is perhaps unique in liking the behavior! :-( Of course, deciding you like the behavior is much easier than doing something to change it. :-)

@Pierre-de-la-Verre

UDL has been designed to support highlighting of programming languages, your use case is a little bit different to this.
At the moment I see 3 ways to make this work.

You write your own lexer You use a scripting plugin and enhance the already defined UDL with the missing features. By using a slightly different approach like the one mentioned by dinkumoil.

When you want to make either 1 or 2 work, there is, for example, the PythonScript plugin which has a logfile lexer as an example script.
In addition, I described here how one can enhance an already defined UDL with pythpn and regex.

@dinkumoil I like notepad++, now some problems, very sorry.

@Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

except maybe for instructional (how would one do it) purposes

Beat you to it. :-)

# encoding=utf-8 """in response to https://notepad-plus-plus.org/community/topic/18512/ Convert this MACRO into PythonScript <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0"> <Action type="2" message="0" wParam="43032" lParam="0" sParam="" /> <!-- DELETE ALL styles --> <!-- NPPM_ --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="A" /> <!-- Write the letter A --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="T" /> <!-- Write the letter T --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="G" /> <!-- Write the letter G --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="C" /> <!-- Write the letter C --> <!-- SCI_ YesString --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43022" lParam="0" sParam="" /> <!-- Apply the 1st STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43024" lParam="0" sParam="" /> <!-- Apply the 2nd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43026" lParam="0" sParam="" /> <!-- Apply the 3rd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43030" lParam="0" sParam="" /> <!-- Apply the 5th STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2454" wParam="0" lParam="0" sParam="" /> <!-- Select to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2180" wParam="0" lParam="0" sParam="" /> <!-- Hit on the DELETE key --> <!-- SCI_ NoString --> </Macro> https://www.bioinformatics.org/sms2/random_dna.html catctaaagggattagttcctgccctcatattcactatccgacccctttaactgtgatgt cctcgctttttctcgtgagagctgtgaatctttgtgccgtttccaacaaggcctggagcc ttttcaatgcttgagggtttcaccgcgggtctaacggatgctaagaaaggggtgcggagg aagggtctttatgctggccgtcggcggttgagagctctgacctataccatggatcccgcg agcgcggttacgggcaataagggcctcactatgcctcgaacacattgtggacaaagtgta gtcgaacccacacacgcgcgagactttagggtgtcgaacagtaccatctaattgatggga agaaatggtttcgtaccacccccgtcgctcagcttagacgggccagagaggggatgggtg gtcagtggcgtcggttggtgaccgtagaattcgttacagagcgatgttgtatagcttttt agacgtaggctagcgttttaacttctacaactccagtgattgggttgatggtctgtttgc ttaccagtcaggtcagctcccgctcatggttctctcgcaaattacttggtcacaccgtga aagctccacgcaaactaatagtgggattctacactaaagggcgtcactatcacttcttat acattatagacgtaactacagtagacatactcgcaagcccgctaacgggagcacagatgt tgagggtatcagcttctgcgactcgggctggatccgatatttttatgcaatgcatctgag actggcctccctgctacctctacggaagctggtacgaagcgcgctgccttcgactgaaac ttgcatgcataagttaatgtagtgcagcgcaggtcagccaacataagtagtgagcccagc cgctggcaggacagttgtcgcggtaaatcacacgtgtggtgaccatctccccatttacag gtgttagaaaagcaacttcgtattaatccattaatctgag """ notepad.menuCommand(43032) # <!-- DELETE ALL styles --> IDM_SEARCH_CLEARALLMARKS = Search > Unmark All > Clear All Styles editor.vCHomeWrap() # <!-- Go to START of line --> editor.replaceSel("A") # <!-- Write the letter A --> editor.replaceSel("T") # <!-- Write the letter T --> editor.replaceSel("G") # <!-- Write the letter G --> editor.replaceSel("C") # <!-- Write the letter C --> editor.vCHomeWrap() # <!-- Go to START of line --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43022) # <!-- Apply the 1st STYLE --> Search > Mark All > Using 1st Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43024) # <!-- Apply the 2nd STYLE --> Search > Mark All > Using 2nd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43026) # <!-- Apply the 3rd STYLE --> Search > Mark All > Using 3rd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43030) # <!-- Apply the 5th STYLE --> Search > Mark All > Using 5th Style editor.charRight() # <!-- Hit the RIGHT key --> editor.vCHomeWrapExtend() # <!-- Select to START of line --> editor.clear() # <!-- Hit on the DELETE key --> # use notepad.menuCommand(43032) or Search > Unmark All > Clear All Styles to clear the styles when done

An overview of the User Defined Languages (accessed through Language > Define Your Language…) can be found in the User Defined Languages page in the official docs. And Ivan Radić has created the definitive guide to the nuts and bolts of UDL version 2.1, which is available at https://ivan-radic.github.io/udl-documentation/ – so definitive that’s it’s linked directly from the Notepad++ UDL dialog.

After looking through those docs, make an attempt at the UDL for Knitr. If you get stuck, show us what you have, how it’s not working for you, and what you would like it to do instead.

Hello, @yohanes-k, @peterjones, @ekopalypse and All,

Oh, my bad ! Reading again my post, I just realize that I’m quite wrong and that the Peter’s solution is the right one !

Why ? because my search regex, in fact, is an alternative between the 2 independent regexes : \d+\K(:) and -(?=\d+) :-((

Actually, the overall regex must be an alternative between the regexes \d+\K:(?=\d+) and \d+\K-(?=\d+) which may be grouped with a ( non-capturing ) group syntax !

Now, in order to be more rigorous, we should mention the name of the Four Evangelists. This gives the following regex S/R :

SEARCH (?-i:Matthew|Mark|Luke|John)\x20\d+\K:(\d+)-(?=\d+)

REPLACE \x20verse\x20\1\x20to\x20

Cheers,

guy038

thanks!

It appears the author of Notepad++ has assigned keycombinations for these keys again (but as yet this is unreleased). See the link I referenced earlier.

He did so in the .rc file for Notepad++. I don’t know too much about how this works, but I’m thinking that will only assign keys if you never change the Localization settings in the Preferences?

If you change localization, what will happen is that a language file will be used which won’t have those keys assigned. Isn’t what truly is needed is those keys to be assigned in all of the language files as well?

There is a plugin called XML Tools which can be used to
check the syntax of an xml file and, if you are having a schema file for your
xml file, you can check if the xml data itself is valid.

@gnulab-id

You can set printing to “Black on white” in preferences Dialog:

5ee5a228-3440-41f1-8f27-baca52142cf3-grafik.png

Plugins options are stored in %AppData%\Notepad++\... hierarchy, the same as Notepad++ options. If you have the cloud setting (Settings > Preferences > Cloud) enabled for Notepad++, that moves it into the appropriate cloud directory; the Plugin options should be moved into that cloud directory as well.

However, the plugins themselves are stored in the executable directory hierarchy; you could just copy the <notepad++.exe directory>\plugins hierarchy over to the new computers

Many thanks, dinkumoil,

for the instructions, very easily done. Works great! Many thanks again!

That is perfect. If it screws me up later in some unexpected way, then I suppose it will not be perfect, but it sure works for now!

@Alan-Kilborn thanks - i re-installed 7.7.1